Skip to main content

pKJ238
(Plasmid #212321)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212321 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KnFunc guide
  • gRNA/shRNA sequence
    GCAGCCACCTCCTTGTTATTG
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKJ238 was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 212321 ; http://n2t.net/addgene:212321 ; RRID:Addgene_212321)
  • For your References section:

    Programmable RNA-guided DNA endonucleases are widespread in eukaryotes and their viruses. Jiang K, Lim J, Sgrizzi S, Trinh M, Kayabolen A, Yutin N, Bao W, Kato K, Koonin EV, Gootenberg JS, Abudayyeh OO. Sci Adv. 2023 Sep 29;9(39):eadk0171. doi: 10.1126/sciadv.adk0171. Epub 2023 Sep 27. 10.1126/sciadv.adk0171 PubMed 37756409