pJet-CMV-IARS1[W435C]-GFP
(Plasmid
#212323)
-
PurposeEGFP-tagged IARS1 Trp435Cys
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJET1.2
- Backbone size w/o insert (bp) 3945
- Total vector size (bp) 8499
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIARS
-
Alt nameIleRS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4554
-
MutationTrp435cys
-
GenBank IDNM_002161.5
-
Entrez GeneIARS1 (a.k.a. GRIDHH, IARS, ILERS, ILRS, IRS, PRO0785)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cactatagggagagcggccg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJet-CMV-IARS1[W435C]-GFP was a gift from Sabine Fuchs (Addgene plasmid # 212323 ; http://n2t.net/addgene:212323 ; RRID:Addgene_212323) -
For your References section:
Isoleucine-to-valine substitutions support cellular physiology during isoleucine deprivation. Kok G, Schene IF, Ilcken EF, Alcaraz PS, Mendes MI, Smith DEC, Salomons G, Shehata S, Jans JJM, Maroofian R, Hoek TA, van Es RM, Rehmann H, Nieuwenhuis EES, Vos HR, Fuchs SA. Nucleic Acids Res. 2025 Jan 7;53(1):gkae1184. doi: 10.1093/nar/gkae1184. 10.1093/nar/gkae1184 PubMed 39657787