pSCALPS-Flag-Mili-EGFP
(Plasmid
#212576)
-
PurposeLentiviral expression of Flag-tagged mouse Mili in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212576 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSCALPS
- Backbone size w/o insert (bp) 7743
- Total vector size (bp) 12615
-
Modifications to backboneEGFP added in frame of insert
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMili
-
Alt namePiwil2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3629
-
GenBank IDNM_001364321
-
Entrez GenePiwil2 (a.k.a. Piwil1l, mili)
- Promoter SFFV
-
Tags
/ Fusion Proteins
- 5x Flag (N terminal on insert)
- SNAP tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGCCAAGAACAGATGGTCC
- 3′ sequencing primer CAACGAGAAGCGCGATCACATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCALPS-Flag-Mili-EGFP was a gift from Phillip Zamore (Addgene plasmid # 212576 ; http://n2t.net/addgene:212576 ; RRID:Addgene_212576) -
For your References section:
GTSF1 accelerates target RNA cleavage by PIWI-clade Argonaute proteins. Arif A, Bailey S, Izumi N, Anzelon TA, Ozata DM, Andersson C, Gainetdinov I, MacRae IJ, Tomari Y, Zamore PD. Nature. 2022 Aug;608(7923):618-625. doi: 10.1038/s41586-022-05009-0. Epub 2022 Jun 30. 10.1038/s41586-022-05009-0 PubMed 35772669