Skip to main content
Addgene
Open Menu

pET22b(+)-Ptac-Ecoli_lpxP
(Plasmid #212594)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 212594 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pET22b(+)
  • Backbone manufacturer
    Novagen (EMD Millipore)
  • Backbone size w/o insert (bp) 5389
  • Total vector size (bp) 6449
  • Modifications to backbone
    T7 promoter has been replaced with tac promoter
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lpxP (5'UTR+CDS)
  • Species
    Escherichia coli K-12
  • Insert Size (bp)
    1060
  • Promoter tac
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTGACAATTAATCATCGGCTCGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET22b(+)-Ptac-Ecoli_lpxP was a gift from Danny Incarnato (Addgene plasmid # 212594 ; http://n2t.net/addgene:212594 ; RRID:Addgene_212594)

  • For your References section:

    Identification of conserved RNA regulatory switches in living cells using RNA secondary structure ensemble mapping and covariation analysis. Borovska I, Zhang C, Dulk SJ, Morandi E, Cardoso MFS, Bourkia BM, van den Homberg DAL, Wolfinger MT, Velema WA, Incarnato D. Nat Biotechnol. 2025 Jul 25. doi: 10.1038/s41587-025-02739-0. 10.1038/s41587-025-02739-0 PubMed 40715458
Related items: