CROPseq-Puro-4xMS2
(Plasmid
#212626)
-
PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particles
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCROPseq-Guide-Puro (Addgene #86708)
-
Backbone manufacturerChristoph Bock Lab
- Total vector size (bp) 10770
-
Modifications to backboneMS2 hairpins were introduced into the 3' UTR of the puromycin mRNA transcript, and the sgRNA scaffold sequence was derived from Dang, et al. (2015). Genome Biology (PMID: 26671237)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-PuroR-4xMS2-WPRE-hU6-sgRNA
-
gRNA/shRNA sequencereplace stuffer sequence with custom sgRNA spacer sequence via BsmBI Golden Gate cloning
-
SpeciesSynthetic
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGGCACTGACAATTCCGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CROPseq-Puro-4xMS2 was a gift from Paul Blainey (Addgene plasmid # 212626 ; http://n2t.net/addgene:212626 ; RRID:Addgene_212626) -
For your References section:
Live-cell transcriptomics with engineered virus-like particles. Najia MA, Borrajo J, Le A, Tsai F, Huang JY, Griffith LG, Daley GQ, Blainey PC. bioRxiv 2024.10.01.616098 10.1101/2024.10.01.616098