pX330-MM002-ZFP143-C-terminal-sgRNA
(Plasmid
#212706)
-
PurposePlasmid for transient expression of pspCas9(BB)-2A-Puro nuclease and sgRNA targetting the C terminal of Zfp143 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 212706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonen/a
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZFP143 C-terminal sgRNA
-
gRNA/shRNA sequenceTTTGCTTCCAAAATACTACA
-
SpeciesM. musculus (mouse)
-
Entrez GeneZfp143 (a.k.a. D7Ertd805e, KRAB14, SBF, Staf, Zfp79, Zfp80-rs1, Znf143, pHZ-1)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byinserts were originally received from Addgene
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-MM002-ZFP143-C-terminal-sgRNA was a gift from Elzo de Wit (Addgene plasmid # 212706 ; http://n2t.net/addgene:212706 ; RRID:Addgene_212706)