pT7CFE1_polio_VP12A
(Plasmid
#212988)
-
PurposeEncodes Poliovirus type I Mahoney VP12A optimized for expression in mammalian transcription/translation extracts
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7CFE1
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4969
-
Vector typeMammalian Cell Free Protein Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePoliovirus type I Mahoney VP12A
-
SpeciesHuman Poliovirus I Mahoney
-
Insert Size (bp)1398
-
GenBank IDV01149.1 V01149.1
- Promoter T7
-
Tag
/ Fusion Protein
- HA tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CACGATGATAATATGGCCTACCCCTACGACG
- 3′ sequencing primer CAGTCAGATCTCAGTGGTGGTGGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7CFE1_polio_VP12A was a gift from Karla Kirkegaard (Addgene plasmid # 212988 ; http://n2t.net/addgene:212988 ; RRID:Addgene_212988)