pBOBI N-HA AXIN1
(Plasmid
#213000)
-
Purposeexpresses mouse AXIN1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBOBI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAXIN1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2496
-
Entrez GeneAxin1 (a.k.a. Axin, Fu, Kb, Ki, fused, kinky, knobbly)
- Promoter cmv
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer PLNCX-F
- 3′ sequencing primer TACTCACCCCAACAGCTGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBOBI N-HA AXIN1 was a gift from Sheng-cai Lin (Addgene plasmid # 213000 ; http://n2t.net/addgene:213000 ; RRID:Addgene_213000) -
For your References section:
Low glucose metabolite 3-phosphoglycerate switches PHGDH from serine synthesis to p53 activation to control cell fate. Wu YQ, Zhang CS, Xiong J, Cai DQ, Wang CZ, Wang Y, Liu YH, Wang Y, Li Y, Wu J, Wu J, Lan B, Wang X, Chen S, Cao X, Wei X, Hu HH, Guo H, Yu Y, Ghafoor A, Xie C, Wu Y, Xu Z, Zhang C, Zhu M, Huang X, Sun X, Lin SY, Piao HL, Zhou J, Lin SC. Cell Res. 2023 Nov;33(11):835-850. doi: 10.1038/s41422-023-00874-4. Epub 2023 Sep 19. 10.1038/s41422-023-00874-4 PubMed 37726403