Skip to main content

pBOBI N-HA AXIN1 delta PHGDH (delta 321-340)
(Plasmid #213005)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213005 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBOBI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AXIN1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2436
  • Entrez Gene
    Axin1 (a.k.a. Axin, Fu, Kb, Ki, fused, kinky, knobbly)
  • Promoter cmv
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer PLNCX-F
  • 3′ sequencing primer TACTCACCCCAACAGCTGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOBI N-HA AXIN1 delta PHGDH (delta 321-340) was a gift from Sheng-cai Lin (Addgene plasmid # 213005 ; http://n2t.net/addgene:213005 ; RRID:Addgene_213005)
  • For your References section:

    Low glucose metabolite 3-phosphoglycerate switches PHGDH from serine synthesis to p53 activation to control cell fate. Wu YQ, Zhang CS, Xiong J, Cai DQ, Wang CZ, Wang Y, Liu YH, Wang Y, Li Y, Wu J, Wu J, Lan B, Wang X, Chen S, Cao X, Wei X, Hu HH, Guo H, Yu Y, Ghafoor A, Xie C, Wu Y, Xu Z, Zhang C, Zhu M, Huang X, Sun X, Lin SY, Piao HL, Zhou J, Lin SC. Cell Res. 2023 Nov;33(11):835-850. doi: 10.1038/s41422-023-00874-4. Epub 2023 Sep 19. 10.1038/s41422-023-00874-4 PubMed 37726403