Skip to main content

pLenti_ABE8e-SpRY-P2A-BFP_HygroR
(Plasmid #213009)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213009 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti_mChe-P2A-BFP_HygroR
  • Modifications to backbone
    Swapped the mcherry construct with a D10A nickase mutant of the Cas9 variant SpRY. Added N-terminal ABE8e from a synthesized sequence block.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ABE8e-SpRY-D10A
  • Species
    Synthetic
  • Mutation
    D10A nickase variant of SpRY
  • Promoter Ef-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagtgcagtagtcgccgt
  • 3′ sequencing primer ggttctcctccacgtctccag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    David Liu (ABE8e-addgene plasmid # 152994) Benjamin Kleinstiver (SpRY-addgene plasmid # 139989)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_ABE8e-SpRY-P2A-BFP_HygroR was a gift from Richard Sherwood (Addgene plasmid # 213009 ; http://n2t.net/addgene:213009 ; RRID:Addgene_213009)
  • For your References section:

    Joint genotypic and phenotypic outcome modeling improves base editing variant effect quantification. Ryu J, Barkal S, Yu T, Jankowiak M, Zhou Y, Francoeur M, Phan QV, Li Z, Tognon M, Brown L, Love MI, Bhat V, Lettre G, Ascher DB, Cassa CA, Sherwood RI, Pinello L. Nat Genet. 2024 Apr 24. doi: 10.1038/s41588-024-01726-6. 10.1038/s41588-024-01726-6 PubMed 38658794