rTTA-gRNA-AAV
(Plasmid
#213036)
-
PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namerTTA-T2A-mCherry
-
Alt namertTA-Advanced tetracycline-controlled transactivator
-
Alt nameHuman UCP1 gRNA-1 CCCGAGGCACCGAGCGAGAAT
-
SpeciesH. sapiens (human), Synthetic
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.03.28.534564 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rTTA-gRNA-AAV was a gift from Nadav Ahituv (Addgene plasmid # 213036 ; http://n2t.net/addgene:213036 ; RRID:Addgene_213036) -
For your References section:
Implantation of engineered adipocytes suppresses tumor progression in cancer models. Nguyen HP, An K, Ito Y, Kharbikar BN, Sheng R, Paredes B, Murray E, Pham K, Bruck M, Zhou X, Biellak C, Ushiki A, Nobuhara M, Fong SL, Bernards DA, Lynce F, Dillon DA, Magbanua MJM, Huppert LA, Hammerlindl H, Klein JA, Valdiviez L, Fiehn O, Esserman L, Desai TA, Yee SW, Rosenbluth JM, Ahituv N. Nat Biotechnol. 2025 Feb 4:10.1038/s41587-024-02551-2. doi: 10.1038/s41587-024-02551-2. 10.1038/s41587-024-02551-2 PubMed 39905264