Skip to main content
Addgene
Open Menu

rTTA-gRNA-AAV
(Plasmid #213036)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213036 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    rTTA-T2A-mCherry
  • Alt name
    rtTA-Advanced tetracycline-controlled transactivator
  • Alt name
    Human UCP1 gRNA-1 CCCGAGGCACCGAGCGAGAAT
  • Species
    H. sapiens (human), Synthetic
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.03.28.534564 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    rTTA-gRNA-AAV was a gift from Nadav Ahituv (Addgene plasmid # 213036 ; http://n2t.net/addgene:213036 ; RRID:Addgene_213036)

  • For your References section:

    Implantation of engineered adipocytes suppresses tumor progression in cancer models. Nguyen HP, An K, Ito Y, Kharbikar BN, Sheng R, Paredes B, Murray E, Pham K, Bruck M, Zhou X, Biellak C, Ushiki A, Nobuhara M, Fong SL, Bernards DA, Lynce F, Dillon DA, Magbanua MJM, Huppert LA, Hammerlindl H, Klein JA, Valdiviez L, Fiehn O, Esserman L, Desai TA, Yee SW, Rosenbluth JM, Ahituv N. Nat Biotechnol. 2025 Feb 4:10.1038/s41587-024-02551-2. doi: 10.1038/s41587-024-02551-2. 10.1038/s41587-024-02551-2 PubMed 39905264
Related items: