pLV-EF1a-MinE-IRES-Blast
(Plasmid
#213115)
-
PurposeExpression of untagged MinE in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213115 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-EF1a
- Backbone size w/o insert (bp) 8528
- Total vector size (bp) 8795
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMinE
-
Insert Size (bp)267
-
Entrez GeneminE (a.k.a. b1174, ECK1162, minB)
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer EF1a_F (TCAAGCCTCAGACAGTGGTTC)
- 3′ sequencing primer EF1a_R (TAGAGGGAAACCGTTGCTAGC)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-EF1a-MinE-IRES-Blast was a gift from Scott Coyle (Addgene plasmid # 213115 ; http://n2t.net/addgene:213115 ; RRID:Addgene_213115) -
For your References section:
A programmable reaction-diffusion system for spatiotemporal cell signaling circuit design. Rajasekaran R, Chang CC, Weix EWZ, Galateo TM, Coyle SM. Cell. 2023 Dec 27:S0092-8674(23)01339-9. doi: 10.1016/j.cell.2023.12.007. 10.1016/j.cell.2023.12.007 PubMed 38181787