pmiRFP670-PCNAL2 (pc3385)
(Plasmid
#213140)
-
PurposeExpresses human PCNA miRFP670 tagged in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213140 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepmiRFP670
-
Backbone manufactureraddgene #79987
- Backbone size w/o insert (bp) 4012
- Total vector size (bp) 4960
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePCNA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_002592.2
-
Entrez GenePCNA (a.k.a. ATLD2)
- Promoter CMV
-
Tag
/ Fusion Protein
- miRFP670 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGTGGATCTCTTCATGTTCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmiRFP670-PCNAL2 (pc3385) was a gift from Cristina Cardoso (Addgene plasmid # 213140 ; http://n2t.net/addgene:213140 ; RRID:Addgene_213140) -
For your References section:
Cytosine base modifications regulate DNA duplex stability and metabolism. Rausch C, Zhang P, Casas-Delucchi CS, Daiss JL, Engel C, Coster G, Hastert FD, Weber P, Cardoso MC. Nucleic Acids Res. 2021 Dec 16;49(22):12870-12894. doi: 10.1093/nar/gkab509. 10.1093/nar/gkab509 PubMed 34133727