Skip to main content

pmiRFP670-PCNAL2 (pc3385)
(Plasmid #213140)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213140 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmiRFP670
  • Backbone manufacturer
    addgene #79987
  • Backbone size w/o insert (bp) 4012
  • Total vector size (bp) 4960
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PCNA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002592.2
  • Entrez Gene
    PCNA (a.k.a. ATLD2)
  • Promoter CMV
  • Tag / Fusion Protein
    • miRFP670 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGTGGATCTCTTCATGTTCGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmiRFP670-PCNAL2 (pc3385) was a gift from Cristina Cardoso (Addgene plasmid # 213140 ; http://n2t.net/addgene:213140 ; RRID:Addgene_213140)
  • For your References section:

    Cytosine base modifications regulate DNA duplex stability and metabolism. Rausch C, Zhang P, Casas-Delucchi CS, Daiss JL, Engel C, Coster G, Hastert FD, Weber P, Cardoso MC. Nucleic Acids Res. 2021 Dec 16;49(22):12870-12894. doi: 10.1093/nar/gkab509. 10.1093/nar/gkab509 PubMed 34133727