Skip to main content

pST
(Plasmid #213143)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213143 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQacR-Q2
  • Backbone manufacturer
    Alec Nielsen
  • Backbone size w/o insert (bp) 5697
  • Total vector size (bp) 7054
  • Modifications to backbone
    Insertion of TtgV-sfGFP biosensor circuit components
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    TtgV sfGFP Biosensor
  • Alt name
    tac-TtgV-sfGFP
  • Insert Size (bp)
    1832
  • Promoter Tac

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGACAATTAATCATCGGCTC
  • 3′ sequencing primer GACGATGAGCGCATTGTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pST was a gift from Radhakrishnan Mahadevan (Addgene plasmid # 213143 ; http://n2t.net/addgene:213143 ; RRID:Addgene_213143)
  • For your References section:

    Design and Characterization of a Generalist Biosensor for Indole Derivatives. Pham C, Stogios PJ, Savchenko A, Mahadevan R. ACS Synth Biol. 2024 Jul 19;13(7):2246-2252. doi: 10.1021/acssynbio.3c00736. Epub 2024 Jun 14. 10.1021/acssynbio.3c00736 PubMed 38875315