Skip to main content

SAM-DNMT3A+sgGFP
(Plasmid #213165)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213165 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXRP_502
  • Modifications to backbone
    Removal of BsmBI site and insertion of DNMT3A
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgGFP
  • gRNA/shRNA sequence
    CAACGAGAAGCGCGATCACA
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACCGACCTCTCTCCCCAGGG
  • 3′ sequencing primer GGCAGTGGAGAGGGCAGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SAM-DNMT3A+sgGFP was a gift from Sefi Rosenbluh (Addgene plasmid # 213165 ; http://n2t.net/addgene:213165 ; RRID:Addgene_213165)
  • For your References section:

    SAM-DNMT3A, a strategy for induction of genome-wide DNA methylation, identifies DNA methylation as a vulnerability in ER-positive breast cancers. Hosseinpour M, Xi X, Liu L, Malaver-Ortega L, Perlaza-Jimenez L, Joo JE, York HM, Beesley J, Caldon CE, Dugue PA, Dowty JG, Arumugam S, Southey MC, Rosenbluh J. Nat Commun. 2024 Dec 1;15(1):10449. doi: 10.1038/s41467-024-54824-8. 10.1038/s41467-024-54824-8 PubMed 39617792