Skip to main content
Addgene

GIO-6
(Plasmid #213390)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213390 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    BioCat GmbH
  • Backbone size w/o insert (bp) 6196
  • Total vector size (bp) 6818
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GIO-6
  • Alt name
    Chimeric synthetic cytokine between IL-6 and OSM
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    605
  • GenBank ID
    NC_000007.14 NC_000022.11
  • Promoter T7
  • Tags / Fusion Proteins
    • IgG1-Fc-tag (C terminal on backbone)
    • Myc-tg (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer AGGCACAGTCGAGGCTG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The molecule was structure-based in-silico designed. The DNA was then synthesized and ordered from BioCat GmbH

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GIO-6 was a gift from Jurgen Scheller (Addgene plasmid # 213390 ; http://n2t.net/addgene:213390 ; RRID:Addgene_213390)

  • For your References section:

    Engineered interleukin-6-derived cytokines recruit artificial receptor complexes and disclose CNTF signaling via the OSMR. Rafii P, Cruz PR, Ettich J, Seibel C, Padrini G, Wittich C, Lang A, Petzsch P, Kohrer K, Moll JM, Floss DM, Scheller J. J Biol Chem. 2024 May;300(5):107251. doi: 10.1016/j.jbc.2024.107251. Epub 2024 Apr 1. 10.1016/j.jbc.2024.107251 PubMed 38569939
Related items: