Fg vector
(Plasmid
#213464)
-
Purpose(Empty Backbone) Destination vector for cloning and transformation into TSI locus 1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFg vector
-
Backbone manufacturerHammond-Kosack' lab
- Backbone size (bp) 4497
-
Modifications to backboneThe resistance cassette and the origin of replication were amplified from pGreen. Then, the amplicon was ligated to a fragment containing: the right border of the TSI locus 1, a cloning site for Golden Gate cloning approach and the partial sequence of the geneticin selection marker.
-
Vector typeBacterial Expression
-
Selectable markersGeneticin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 5′ sequencing primer GGGGGTTTCGGAATGTCGTC
- 3′ sequencing primer CCGATAAATCGCGAAACAAGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fg vector was a gift from Kim Hammond-Kosack (Addgene plasmid # 213464 ; http://n2t.net/addgene:213464 ; RRID:Addgene_213464) -
For your References section:
Identification and functional characterisation of a locus for target site integration in Fusarium graminearum. Darino M, Urban M, Kaur N, Machado Wood A, Grimwade-Mann M, Smith D, Beacham A, Hammond-Kosack K. Fungal Biol Biotechnol. 2024 Feb 26;11(1):2. doi: 10.1186/s40694-024-00171-8. 10.1186/s40694-024-00171-8 PubMed 38409036