Skip to main content

pJET-PtrpC
(Plasmid #213465)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213465 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJET
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 2974
  • Total vector size (bp) 3385
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Promoter of tryptophan synthase of Aspergillus nidulans
  • Species
    Aspergillus nidulans
  • Insert Size (bp)
    411
  • GenBank ID
    X02390.1

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGAGCAGGTTCCATTCATTG
  • 3′ sequencing primer GTTCCTGATGAGGTGGTTAGCATAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET-PtrpC was a gift from Kim Hammond-Kosack (Addgene plasmid # 213465 ; http://n2t.net/addgene:213465 ; RRID:Addgene_213465)
  • For your References section:

    Identification and functional characterisation of a locus for target site integration in Fusarium graminearum. Darino M, Urban M, Kaur N, Machado Wood A, Grimwade-Mann M, Smith D, Beacham A, Hammond-Kosack K. Fungal Biol Biotechnol. 2024 Feb 26;11(1):2. doi: 10.1186/s40694-024-00171-8. 10.1186/s40694-024-00171-8 PubMed 38409036