pJET-TtrpC
(Plasmid
#213467)
-
PurposeVector containing the TrpC terminator for Golden Gate cloning in the Fg vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213467 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJET
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 3526
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTerminator of tryptophan synthase of Aspergillus nidulans
-
SpeciesAspergillus nidulans
-
Insert Size (bp)552
-
GenBank IDX02390.1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET-TtrpC was a gift from Kim Hammond-Kosack (Addgene plasmid # 213467 ; http://n2t.net/addgene:213467 ; RRID:Addgene_213467) -
For your References section:
Identification and functional characterisation of a locus for target site integration in Fusarium graminearum. Darino M, Urban M, Kaur N, Machado Wood A, Grimwade-Mann M, Smith D, Beacham A, Hammond-Kosack K. Fungal Biol Biotechnol. 2024 Feb 26;11(1):2. doi: 10.1186/s40694-024-00171-8. 10.1186/s40694-024-00171-8 PubMed 38409036