pJET-LB-geneticin
(Plasmid
#213468)
-
PurposeVector to amplify the LB-geneticin fragment for transformation into TSI locus 1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJET
-
Backbone manufacturerThermoFisher Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 5080
-
Modifications to backboneNo
-
Vector typeBacterial Expression
-
Selectable markersGeneticin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLeft border of the TSI locus 1-split fragment of geneticin cassette
-
SpeciesFusarium graminearum PH-1
-
Insert Size (bp)2106
-
GenBank ID229533
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET-LB-geneticin was a gift from Kim Hammond-Kosack (Addgene plasmid # 213468 ; http://n2t.net/addgene:213468 ; RRID:Addgene_213468) -
For your References section:
Identification and functional characterisation of a locus for target site integration in Fusarium graminearum. Darino M, Urban M, Kaur N, Machado Wood A, Grimwade-Mann M, Smith D, Beacham A, Hammond-Kosack K. Fungal Biol Biotechnol. 2024 Feb 26;11(1):2. doi: 10.1186/s40694-024-00171-8. 10.1186/s40694-024-00171-8 PubMed 38409036