pJG01
(Plasmid
#213505)
-
Purposeexpresses TdTomato in Capsaspora owczarzaki
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJP72
-
Backbone manufacturerDuojia Pan (based on pUC57-mini from Genscript)
- Backbone size w/o insert (bp) 4221
- Total vector size (bp) 5652
-
Modifications to backboneTdTomato was codon-optimized for Capsaspora owczarzaki and synthesized. The mScarlet gene ORF of pJP72 was directly replaced with the ORF of this TdTomato gene
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTdTomato
-
SpeciesSynthetic; ; Capsaspora owczarzaki
-
Insert Size (bp)1431
- Promoter EF1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATTTGGAAATGCTCACTCTTCC
- 3′ sequencing primer TGAAATAAACAAATGTGTCTTGGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypJP72 was a gift from Duojia Pan (Addgene plasmid # 176479 ; http://n2t.net/addgene:176479 ; RRID:Addgene_176479)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJG01 was a gift from Joseph Gerdt (Addgene plasmid # 213505 ; http://n2t.net/addgene:213505 ; RRID:Addgene_213505)