pRSF_his6_sumo_229E_NSP14
(Plasmid
#213521)
-
PurposeExpresses NSP14 of hCoV 229E
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSF-His6-sumo
- Backbone size w/o insert (bp) 3900
- Total vector size (bp) 5500
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehCoV 229E NSP14
-
SpecieshCoV 229E
-
Insert Size (bp)1551
-
Tag
/ Fusion Protein
- His6-sumo (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGCTGATGGAAGCGTTCGCTA
- 3′ sequencing primer T7-term (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF_his6_sumo_229E_NSP14 was a gift from Thomas Tuschl (Addgene plasmid # 213521 ; http://n2t.net/addgene:213521 ; RRID:Addgene_213521) -
For your References section:
Small-molecule inhibition of SARS-CoV-2 NSP14 RNA cap methyltransferase. Meyer C, Garzia A, Miller MW, Huggins DJ, Myers RW, Hoffmann HH, Ashbrook AW, Jannath SY, Liverton N, Kargman S, Zimmerman M, Nelson AM, Sharma V, Dolgov E, Cangialosi J, Penalva-Lopez S, Alvarez N, Chang CW, Oswal N, Gonzalez I, Rasheed R, Goldgirsh K, Davis JA, Ramos-Espiritu L, Menezes MR, Larson C, Nitsche J, Ganichkin O, Alwaseem H, Molina H, Steinbacher S, Glickman JF, Perlin DS, Rice CM, Meinke PT, Tuschl T. Nature. 2024 Dec 11. doi: 10.1038/s41586-024-08320-0. 10.1038/s41586-024-08320-0 PubMed 39663451