pRSF_his6_sumo_hRNMT_RAM
              
              
                (Plasmid
                
                #213528)
              
            
            
            
          - 
            PurposeExpresses the human RNMT-RAM complex
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213528 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRSF-His6-sumo
 - Backbone size w/o insert (bp) 3900
 - Total vector size (bp) 5900
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert 1
- 
                Gene/Insert namehuman RNMT
 - 
                  Alt nameRNMT
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)1431
 - 
                        Entrez GeneRNMT (a.k.a. CMT1, CMT1c, MET, Met, N7-MTase, RG7MT1, cm1p, hCMT1, hMet)
 - 
    
        Tag
        / Fusion Protein
    
- His6-sumo (N terminal on backbone)
 
 
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
 - 5′ cloning site BamHI (not destroyed)
 - 3′ cloning site AscI (not destroyed)
 - 5′ sequencing primer GGCTGATGGAAGCGTTCGCTA
 - 3′ sequencing primer T7-term (Common Sequencing Primers)
 
Gene/Insert 2
- 
                Gene/Insert nameRAM
 - 
                  Alt nameRAM
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)357
 
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
 - 5′ cloning site NdeI (not destroyed)
 - 3′ cloning site XhoI (not destroyed)
 - 5′ sequencing primer GGCTGATGGAAGCGTTCGCTA
 - 3′ sequencing primer T7-term (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pRSF_his6_sumo_hRNMT_RAM was a gift from Thomas Tuschl (Addgene plasmid # 213528 ; http://n2t.net/addgene:213528 ; RRID:Addgene_213528) - 
                
For your References section:
Small-molecule inhibition of SARS-CoV-2 NSP14 RNA cap methyltransferase. Meyer C, Garzia A, Miller MW, Huggins DJ, Myers RW, Hoffmann HH, Ashbrook AW, Jannath SY, Liverton N, Kargman S, Zimmerman M, Nelson AM, Sharma V, Dolgov E, Cangialosi J, Penalva-Lopez S, Alvarez N, Chang CW, Oswal N, Gonzalez I, Rasheed R, Goldgirsh K, Davis JA, Ramos-Espiritu L, Menezes MR, Larson C, Nitsche J, Ganichkin O, Alwaseem H, Molina H, Steinbacher S, Glickman JF, Perlin DS, Rice CM, Meinke PT, Tuschl T. Nature. 2024 Dec 11. doi: 10.1038/s41586-024-08320-0. 10.1038/s41586-024-08320-0 PubMed 39663451