pCTCON2-Aga2p-Flag-CapN-TEVcs-HA
(Plasmid
#213530)
-
PurposeExpresses CapN-caged TEVcs on yeast surface
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213530 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCTCON2
- Backbone size w/o insert (bp) 5800
- Total vector size (bp) 6683
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAga2p-Flag-CapN-TEVcs-HA
-
Alt nameCapN caging TEVcs on yeast surface
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)830
- Promoter Gal1/10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATACCTCTATACTTTAACGTCAAGGAG
- 3′ sequencing primer gagaaatgaaaagtatattgtattttgtacgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCTCON2-Aga2p-Flag-CapN-TEVcs-HA was a gift from Wenjing Wang (Addgene plasmid # 213530 ; http://n2t.net/addgene:213530 ; RRID:Addgene_213530) -
For your References section:
A general method for chemogenetic control of peptide function. Shen J, Geng L, Li X, Emery C, Kroning K, Shingles G, Lee K, Heyden M, Li P, Wang W. Nat Methods. 2023 Jan;20(1):112-122. doi: 10.1038/s41592-022-01697-8. Epub 2022 Dec 8. 10.1038/s41592-022-01697-8 PubMed 36481965