plx208-CMV-Gal4DBD-CapN-SsrA-CapC
(Plasmid
#213533)
-
PurposeExpresses one of the split transcription factor component in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLX208
- Backbone size w/o insert (bp) 6772
-
Modifications to backboneno Hygromycin
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSspB-EGFP-VP16
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1266
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plx208-CMV-Gal4DBD-CapN-SsrA-CapC was a gift from Wenjing Wang (Addgene plasmid # 213533 ; http://n2t.net/addgene:213533 ; RRID:Addgene_213533) -
For your References section:
A general method for chemogenetic control of peptide function. Shen J, Geng L, Li X, Emery C, Kroning K, Shingles G, Lee K, Heyden M, Li P, Wang W. Nat Methods. 2023 Jan;20(1):112-122. doi: 10.1038/s41592-022-01697-8. Epub 2022 Dec 8. 10.1038/s41592-022-01697-8 PubMed 36481965