pRK5-PLBD2-6xHis S392A
(Plasmid
#213607)
-
PurposeExpresses PLBD2-6xHis S392A in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRK5
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephospholipase B domain containing 2
-
Alt namePLBD2
-
Alt nameP76
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1886
-
MutationChanged serine 392 to alanine
-
GenBank ID196463
-
Entrez GenePLBD2 (a.k.a. P76)
- Promoter CMV
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCAGGTCCAACTGCACCTCGGTTCTATCGATTGAATTC
- 3′ sequencing primer GCGGCCGCTAAGTAAGTAAGGATCCCCAGCTTGGCCGCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5-PLBD2-6xHis S392A was a gift from Monther Abu-Remaileh (Addgene plasmid # 213607 ; http://n2t.net/addgene:213607 ; RRID:Addgene_213607) -
For your References section:
Glycerophosphodiesters inhibit lysosomal phospholipid catabolism in Batten disease. Nyame K, Hims A, Aburous A, Laqtom NN, Dong W, Medoh UN, Heiby JC, Xiong J, Ori A, Abu-Remaileh M. Mol Cell. 2024 Apr 4;84(7):1354-1364.e9. doi: 10.1016/j.molcel.2024.02.006. Epub 2024 Mar 5. 10.1016/j.molcel.2024.02.006 PubMed 38447580