POC1465
(Plasmid
#213742)
-
PurposeBsaI-associated non-switchable methylase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET15b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5708
- Total vector size (bp) 6870
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTruncated non-switchable methylase M2.Eco31I
-
Alt nameM2.Eco31I_2
-
SpeciesE. coli RFL31
-
Insert Size (bp)1170
-
GenBank IDAF458982
- Promoter T7
-
Tag
/ Fusion Protein
- His6-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CTAGCCATATGATTCCAAACCACAAGG
- 3′ sequencing primer CTAGGGATCCTTAAAGCGACGGCTTAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
POC1465 was a gift from Christopher A. O'Callaghan (Addgene plasmid # 213742 ; http://n2t.net/addgene:213742 ; RRID:Addgene_213742) -
For your References section:
DNA methylases for site-selective inhibition of type IIS restriction enzyme activity. Flores-Fernandez CN, Lin D, Robins K, O'Callaghan CA. Appl Microbiol Biotechnol. 2024 Jan 25;108(1):174. doi: 10.1007/s00253-024-13015-7. 10.1007/s00253-024-13015-7 PubMed 38270650