POC1481
(Plasmid
#213807)
-
PurposeLguI-associated switch methylase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 7179
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLguI-associated switch methylase M.XmnI
-
SpeciesX. manihotis 7AS1
-
Insert Size (bp)1863
-
GenBank IDU44748
- Promoter T7
-
Tag
/ Fusion Protein
- His6-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CTAGCGCTAGCATGCGTGATCTTGCTAGTACTTATCG
- 3′ sequencing primer CTAGAAGCTTTTACCCGGCGCGCAAACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
POC1481 was a gift from Christopher A. O'Callaghan (Addgene plasmid # 213807 ; http://n2t.net/addgene:213807 ; RRID:Addgene_213807) -
For your References section:
DNA methylases for site-selective inhibition of type IIS restriction enzyme activity. Flores-Fernandez CN, Lin D, Robins K, O'Callaghan CA. Appl Microbiol Biotechnol. 2024 Jan 25;108(1):174. doi: 10.1007/s00253-024-13015-7. 10.1007/s00253-024-13015-7 PubMed 38270650