pMK053
(Plasmid
#213963)
-
PurposeDual-Reporter Plasmid for mRNA 3'UTR Massively Parallel Reporter Assays
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBTV
-
Backbone manufacturerAddgene #84771
- Total vector size (bp) 10000
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3'UTR cloning site
-
Alt name3'UTR cloning site
-
SpeciesSynthetic
-
Insert Size (bp)10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer ctgctagctagatgactaaacgc
- 3′ sequencing primer gtggtctggatccaccggtcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMK053 was a gift from Hani Goodarzi (Addgene plasmid # 213963 ; http://n2t.net/addgene:213963 ; RRID:Addgene_213963) -
For your References section:
A systematic search for RNA structural switches across the human transcriptome. Khoroshkin M, Asarnow D, Zhou S, Navickas A, Winters A, Goudreau J, Zhou SK, Yu J, Palka C, Fish L, Borah A, Yousefi K, Carpenter C, Ansel KM, Cheng Y, Gilbert LA, Goodarzi H. Nat Methods. 2024 Sep;21(9):1634-1645. doi: 10.1038/s41592-024-02335-1. Epub 2024 Jul 16. 10.1038/s41592-024-02335-1 PubMed 39014073