Skip to main content

pMK053
(Plasmid #213963)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213963 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BTV
  • Backbone manufacturer
    Addgene #84771
  • Total vector size (bp) 10000
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3'UTR cloning site
  • Alt name
    3'UTR cloning site
  • Species
    Synthetic
  • Insert Size (bp)
    10

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer ctgctagctagatgactaaacgc
  • 3′ sequencing primer gtggtctggatccaccggtcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMK053 was a gift from Hani Goodarzi (Addgene plasmid # 213963 ; http://n2t.net/addgene:213963 ; RRID:Addgene_213963)
  • For your References section:

    A systematic search for RNA structural switches across the human transcriptome. Khoroshkin M, Asarnow D, Zhou S, Navickas A, Winters A, Goudreau J, Zhou SK, Yu J, Palka C, Fish L, Borah A, Yousefi K, Carpenter C, Ansel KM, Cheng Y, Gilbert LA, Goodarzi H. Nat Methods. 2024 Sep;21(9):1634-1645. doi: 10.1038/s41592-024-02335-1. Epub 2024 Jul 16. 10.1038/s41592-024-02335-1 PubMed 39014073