AWP-029
(Plasmid
#213966)
-
PurposeExpresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for gRNA constitutive expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213966 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNBU2
- Backbone size w/o insert (bp) 6814
- Total vector size (bp) 10678
-
Modifications to backboneCassette for constitutive expression of Cas12a gRNAs. Spacers can be cloned in the SmaI site.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsErythromycin resistance in Bacteroides.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas12a
-
SpeciesSynthetic; Segatella bryantii
-
Insert Size (bp)3798
-
MutationD875A to inactivate target nuclease activity
-
GenBank ID
-
Entrez Genecas12a (a.k.a. L6471_RS03565, L6471_03570)
- Promoter PcfxA, IPTG inducible
-
Tag
/ Fusion Protein
- 3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gcttgccctcatctgttacg
- 3′ sequencing primer caagatccttaatcatcatc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from pMM704 (Addgene #68891).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AWP-029 was a gift from Alexander Westermann (Addgene plasmid # 213966 ; http://n2t.net/addgene:213966 ; RRID:Addgene_213966) -
For your References section:
CRISPR-based screening of small RNA modulators of bile susceptibility in Bacteroides thetaiotaomicron. Prezza G, Liao C, Reichardt S, Beisel CL, Westermann AJ. Proc Natl Acad Sci U S A. 2024 Feb 6;121(6):e2311323121. doi: 10.1073/pnas.2311323121. Epub 2024 Jan 31. 10.1073/pnas.2311323121 PubMed 38294941