INS-IRES-EGFP
(Plasmid
#214021)
-
PurposeGFP fluorescent reporter for insulin gene expression. IRES-EGFP and PuroR with homology arms for human insulin gene.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneInsulin IRES plasmid
-
Backbone manufacturerin house
- Backbone size w/o insert (bp) 8597
- Total vector size (bp) 9311
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
-
Insert Size (bp)714
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGACGTGGTTTTCCTTTGAA
- 3′ sequencing primer ATgctagcgaacaaacgacccaacacccgtgcgttttattctgtctttttattgccacgcgtGGATCCttacttgtacagctcgtccatgccgagagtgatcccggcggcggtcacgaactccag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
INS-IRES-EGFP was a gift from Dieter Egli (Addgene plasmid # 214021 ; http://n2t.net/addgene:214021 ; RRID:Addgene_214021)
Map uploaded by the depositor.
