pEMJ_042
(Plasmid
#214061)
-
PurposeT7 inducible LanTERN (pRSET)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSET
- Backbone size w/o insert (bp) 2955
- Total vector size (bp) 4212
-
Modifications to backboneRemoval of some sequence 3' of insert.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLanTERN
-
SpeciesSynthetic
-
Insert Size (bp)1257
- Promoter T7
-
Tags
/ Fusion Proteins
- 6x His (N terminal on backbone)
- T7 Tag (N terminal on backbone)
- Xpress(tm) Tag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7
- 3′ sequencing primer ggctgattatgatctagagtcgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMJ_042 was a gift from Pamela Silver (Addgene plasmid # 214061 ; http://n2t.net/addgene:214061 ; RRID:Addgene_214061) -
For your References section:
LanTERN: A Fluorescent Sensor That Specifically Responds to Lanthanides. Jones EM, Su Y, Sander C, Justman QA, Springer M, Silver PA. ACS Synth Biol. 2024 Feb 20. doi: 10.1021/acssynbio.3c00600. 10.1021/acssynbio.3c00600 PubMed 38377571