Skip to main content

lenti-EGFR-T790M-nick sgRNA
(Plasmid #214098)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214098 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lenti-sgRNA blast (Plasmid #104993)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFR T790M nicking sgRNA
  • gRNA/shRNA sequence
    CCTCCAGGAAGCCTACGTGA
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-EGFR-T790M-nick sgRNA was a gift from Ting Zhou (Addgene plasmid # 214098 ; http://n2t.net/addgene:214098 ; RRID:Addgene_214098)
  • For your References section:

    Robust and inducible genome editing via an all-in-one prime editor in human pluripotent stem cells. Wu Y, Zhong A, Sidharta M, Kim TW, Ramirez B, Persily B, Studer L, Zhou T. Nat Commun. 2024 Dec 30;15(1):10824. doi: 10.1038/s41467-024-55104-1. 10.1038/s41467-024-55104-1 PubMed 39737975