pET-11a-pH-LeuRS_WT
(Plasmid
#214193)
-
Purposefor expressing full length LeuRS-WT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-11a
-
Backbone manufacturerNovagene
- Backbone size w/o insert (bp) 5677
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFull length Pyrococcuas Horikoshii Leucyl-tRNA synthetase_WT
-
Alt nameFL-Ph-LeuRS_WT
-
SpeciesFull length Pyrococcuas Horikoshii Leucyl-tRNA synthetase
-
GenBank IDNC_000961.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer catatgcatcaccatcaccatcacgcg
- 3′ sequencing primer gctcagcttatcattcaataaaaatcgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-11a-pH-LeuRS_WT was a gift from Charles Carter (Addgene plasmid # 214193)