pSG075
(Plasmid
#214258)
-
PurposeHybrid PaFtsH2NFtsH1 protease: PaftsH2SD -PaftsH11-453-PaftsH2463-1881 in pJN105
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJN105
- Backbone size w/o insert (bp) 6055
- Total vector size (bp) 7915
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionstransfer into Pseudomonas aeruginosa SG17M, SG17M ΔftsH1 ΔftsH2 or other Pseudomonas aeruginosa ΔftsH1 strain
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHybrid PaFtsH protease PaFtsH2NFtsH1 of Pseudomonas aeruginosa SG17M
-
SpeciesPseudomonas aeruginosa SG17M
-
Insert Size (bp)1890
-
MutationHybrid PaFtsH2NFtsH1 protease: First 18 nucleotides: PaftsH2 Shine-Dalgarno sequence; Hybrid ORF: PaftsH1, nucleotides 1-453 and PaftsH2, nucleotides 463-1881
-
GenBank IDNZ_JALF00000000.1 Z695_RS45375 and Z695_RS57205
- Promoter araBAD promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer CGCGCTAGCTTGCGAGGAACATTGCCCATGGCAAAGAATCTGATTCT
- 3′ sequencing primer GCGTCTAGATCATGGTGTGGACCCTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG075 was a gift from Ute Romling (Addgene plasmid # 214258 ; http://n2t.net/addgene:214258 ; RRID:Addgene_214258) -
For your References section:
The membrane-cytoplasmic linker defines activity of FtsH proteases in Pseudomonas aeruginosa clone C. Mawla GD, Kamal SM, Cao LY, Purhonen P, Hebert H, Sauer RT, Baker TA, Romling U. J Biol Chem. 2024 Feb;300(2):105622. doi: 10.1016/j.jbc.2023.105622. Epub 2024 Jan 3. 10.1016/j.jbc.2023.105622 PubMed 38176647