pcDNA3.1-Hyg-BFP-P2A-otPKR-FL
(Plasmid
#214360)
-
PurposeExpression of the Blue Fluorescent Protein - P2A - full length protein kinase R from chinook salmon
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214360 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1-(-)-Hyg
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBFP-P2A-otPKRFL
-
SpeciesAequorea victoria, Oncorhynchus tshawytscha
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Hyg-BFP-P2A-otPKR-FL was a gift from Bertrand Collet (Addgene plasmid # 214360 ; http://n2t.net/addgene:214360 ; RRID:Addgene_214360)