Skip to main content

pcDNA3-Neo-LUC
(Plasmid #214368)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214368 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3-Neo
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LUC
  • Species
    Photinus pyralis
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Neo-LUC was a gift from Bertrand Collet (Addgene plasmid # 214368 ; http://n2t.net/addgene:214368 ; RRID:Addgene_214368)
  • For your References section:

    Salmonid Double-stranded RNA-Dependent Protein Kinase Activates Apoptosis and Inhibits Protein Synthesis. Chaumont L, Peruzzi M, Huetz F, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. J Immunol. 2024 Jul 26:ji2400076. doi: 10.4049/jimmunol.2400076. 10.4049/jimmunol.2400076 PubMed 39058317