Skip to main content

mCherry-Vector
(Plasmid #214477)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214477 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    mCherry-Ezrin-N-14
  • Backbone manufacturer
    Michael Davidson, Addgene Plasmid #55043
  • Total vector size (bp) 4690
  • Modifications to backbone
    The backbone of mCherry-Ezrin-N-14 from Michael Davidson was PCR amplified and ligated to generate the vector.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    Discosoma sp (sea anemone)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was created by PCR amplifying the backbone of Addgene plasmid # 55043 (a gift from Michael Davidson; http://n2t.net/addgene:55043; RRID:Addgene_55043) followed by ligation of the linear product. The primers for PCR amplification are available in the supplemental materials for Miller et al.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-Vector was a gift from Natalie Ahn (Addgene plasmid # 214477 ; http://n2t.net/addgene:214477 ; RRID:Addgene_214477)
  • For your References section:

    Cooperative polarization of MCAM/CD146 and ERM family proteins in melanoma. Miller SG, Hoh M, Ebmeier CC, Tay JW, Ahn NG. Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255. 10.1091/mbc.E23-06-0255 PubMed 38117590