mCherry-Vector
(Plasmid
#214477)
-
PurposeVector control for mCherry fusions. Created from the backbone of Addgene #55043 mCherry-Ezrin-N-14 from Michael Davidson.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 214477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonemCherry-Ezrin-N-14
-
Backbone manufacturerMichael Davidson, Addgene Plasmid #55043
- Total vector size (bp) 4690
-
Modifications to backboneThe backbone of mCherry-Ezrin-N-14 from Michael Davidson was PCR amplified and ligated to generate the vector.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesDiscosoma sp (sea anemone)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySource plasmid was obtained from Addgene (plasmid # 55043 mCherry-Ezrin-N-14), from Michael Davidson.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was created by PCR amplifying the backbone of Addgene plasmid # 55043 (a gift from Michael Davidson; http://n2t.net/addgene:55043; RRID:Addgene_55043) followed by ligation of the linear product. The primers for PCR amplification are available in the supplemental materials for Miller et al.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-Vector was a gift from Natalie Ahn (Addgene plasmid # 214477 ; http://n2t.net/addgene:214477 ; RRID:Addgene_214477) -
For your References section:
Cooperative polarization of MCAM/CD146 and ERM family proteins in melanoma. Miller SG, Hoh M, Ebmeier CC, Tay JW, Ahn NG. Mol Biol Cell. 2023 Dec 20:mbcE23060255. doi: 10.1091/mbc.E23-06-0255. 10.1091/mbc.E23-06-0255 PubMed 38117590