Skip to main content

pH2B-6AA-ffDronpa
(Plasmid #214606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214606 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    from pEGFP-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ffDronpa-H2B
  • Insert Size (bp)
    1705
  • Promoter CMV
  • Tag / Fusion Protein
    • H2B targetting with a linker of 6AA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH2B-6AA-ffDronpa was a gift from Peter Dedecker (Addgene plasmid # 214606 ; http://n2t.net/addgene:214606 ; RRID:Addgene_214606)
  • For your References section:

    Per-pixel unmixing of spectrally overlapping fluorophores using intra-exposure excitation modulation. Valenta H, Bierbuesse F, Vitale R, Ruckebusch C, Vandenberg W, Dedecker P. Talanta. 2024 Mar 10.1016/j.talanta.2023.125397 PubMed 38048682