pH2B-6AA-ffDronpa
              
              
                (Plasmid
                
                #214606)
              
            
            
            
          - 
            PurposeExpresses reversibly switchable fluorescent protein ffDronpa targeted to the nucleus
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonefrom pEGFP-N1
- 
              Vector typeMammalian Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameffDronpa-H2B
- 
                  Insert Size (bp)1705
- Promoter CMV
- 
    
        Tag
        / Fusion Protein
    - H2B targetting with a linker of 6AA (N terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GAGGTCTATATAAGCAGAGC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pH2B-6AA-ffDronpa was a gift from Peter Dedecker (Addgene plasmid # 214606 ; http://n2t.net/addgene:214606 ; RRID:Addgene_214606)
- 
                For your References section: Per-pixel unmixing of spectrally overlapping fluorophores using intra-exposure excitation modulation. Valenta H, Bierbuesse F, Vitale R, Ruckebusch C, Vandenberg W, Dedecker P. Talanta. 2024 Mar 10.1016/j.talanta.2023.125397 PubMed 38048682
 
    
 
                         
             
            