AAVi U6_gRNA CMV_SadCas9-KRAB
(Plasmid
#214609)
-
PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2747
- Total vector size (bp) 7381
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namegRNA
-
Alt namenuclease-dead S. aureus Cas9
-
Insert Size (bp)120
-
GenBank ID
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSadCas9
-
Alt namenuclease-dead S. aureus Cas9
-
SpeciesS. aureus
-
Insert Size (bp)3564
-
MutationD10A, N580A
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- NP NLS (C terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The full insert between ITRs was cloned from a synthetic fragment.
The Sa gRNA scaffold sequence was modified from Ran et al Nature 2015 doi: 10.1038/nature14299.
The SadCas9-KRAB sequence is based on Thakore et al Nat Commun. 2018 doi: 10.1038/s41467-018-04048-4.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVi U6_gRNA CMV_SadCas9-KRAB was a gift from Ralf Gilsbach (Addgene plasmid # 214609 ; http://n2t.net/addgene:214609 ; RRID:Addgene_214609) -
For your References section:
In Vivo Silencing of Regulatory Elements Using a Single AAV-CRISPRi Vector. Laurette P, Cao C, Ramanujam D, Schwaderer M, Lueneburg T, Kuss S, Weiss L, Dilshat R, Furlong EEM, Rezende F, Engelhardt S, Gilsbach R. Circ Res. 2023 Dec 22. doi: 10.1161/CIRCRESAHA.123.323854. 10.1161/CIRCRESAHA.123.323854 PubMed 38131200