pDual_dsCas9_Venus_hs_NQO1
(Plasmid
#214684)
-
PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human NQO1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDual_dsCas9_Venus
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedgRNA_NQO1
-
gRNA/shRNA sequenceCAGCAAACCTTCAGCTACAG; CCATCTGAGCCCAGATATTG
-
SpeciesH. sapiens (human)
-
Entrez GeneNQO1 (a.k.a. DHQU, DIA4, DTD, NMOR1, NMORI, QR1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDual_dsCas9_Venus_hs_NQO1 was a gift from Kevin Janes (Addgene plasmid # 214684 ; http://n2t.net/addgene:214684 ; RRID:Addgene_214684)