pDual_dsCas9_Puro_hs_TP73
(Plasmid
#214689)
-
PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDual_dsCas9_Puro
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedgRNA_TP73
-
gRNA/shRNA sequenceGCCTTCGGTTTCCAGCCGCG; CAGCATGGACGTCTTCCACC
-
SpeciesH. sapiens (human)
-
MutationPuromycin resistance cassette has silent mutations to remove BsmBI recognition sequence (CGTCTCG->AGTGAGC; aas:GVS; 8645-8651 on the plasmid)
-
Entrez GeneTP73 (a.k.a. CILD47, P73)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDual_dsCas9_Puro_hs_TP73 was a gift from Kevin Janes (Addgene plasmid # 214689 ; http://n2t.net/addgene:214689 ; RRID:Addgene_214689)