Skip to main content
Addgene
Open Menu

#1.4 post-R-SynapShot-Lyn-miRFP670
(Plasmid #214718)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214718 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 214718-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 214718-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG
  • Total vector size (bp) 9651
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    #1.4 post-R-SynapShot
  • Species
    Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • Lyn-miRFP670 (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CTACAGCTCCTGGGCAACGTGC
  • 3′ sequencing primer TGATAGACACAAAAAATTCCAACACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    #1.4 post-R-SynapShot-Lyn-miRFP670 was a gift from Won Do Heo (Addgene plasmid # 214718 ; http://n2t.net/addgene:214718 ; RRID:Addgene_214718)

  • For your References section:

    Real-time visualization of structural dynamics of synapses in live cells in vivo. Son S, Nagahama K, Lee J, Jung K, Kwak C, Kim J, Noh YW, Kim E, Lee S, Kwon HB, Heo WD. Nat Methods. 2024 Jan 8. doi: 10.1038/s41592-023-02122-4. 10.1038/s41592-023-02122-4 PubMed 38191933
Related items:
Commonly requested with: