- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21476 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepEGFP-C3
- 
              Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namerho/rac guanine nucleotide exchange factor (GEF) 2
- 
                  Alt nameGEF-DN
- 
                  Alt nameArhgef2
- 
                    SpeciesR. norvegicus (rat)
- 
                  Insert Size (bp)3000
- 
                  MutationT274A
- 
                    GenBank IDNM_001012079
- 
                        Entrez GeneArhgef2 (a.k.a. MGC95068)
- 
    
        Tag
        / Fusion Protein
    - eGFP (C terminal on insert)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal I (not destroyed)
- 3′ cloning site Dra I (not destroyed)
- 5′ sequencing primer custom (gtacgtagtcgaccatgtctcggatcgaatcc) (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: GEF-DN was a gift from Richard Huganir (Addgene plasmid # 21476)
- 
                For your References section: AMPA receptor and GEF-H1/Lfc complex regulates dendritic spine development through RhoA signaling cascade. Kang MG, Guo Y, Huganir RL. Proc Natl Acad Sci U S A. 2009 Mar 3. 106(9):3549-54. 10.1073/pnas.0812861106 PubMed 19208802
