Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GEF-DN
(Plasmid #21476)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21476 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rho/rac guanine nucleotide exchange factor (GEF) 2
  • Alt name
    GEF-DN
  • Alt name
    Arhgef2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3000
  • Mutation
    T274A
  • GenBank ID
    NM_001012079
  • Entrez Gene
    Arhgef2 (a.k.a. MGC95068)
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (not destroyed)
  • 3′ cloning site Dra I (not destroyed)
  • 5′ sequencing primer custom (gtacgtagtcgaccatgtctcggatcgaatcc)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GEF-DN was a gift from Richard Huganir (Addgene plasmid # 21476)
  • For your References section:

    AMPA receptor and GEF-H1/Lfc complex regulates dendritic spine development through RhoA signaling cascade. Kang MG, Guo Y, Huganir RL. Proc Natl Acad Sci U S A. 2009 Mar 3. 106(9):3549-54. 10.1073/pnas.0812861106 PubMed 19208802