lentiviral shRNA GEF-H1
(Plasmid #21477)

• Depositing Lab: Richard Huganir
• Publication: Kang et al Proc Natl Acad Sci U S A. 2009 Mar 3. 106(9):3549-54.

Backbone

• Vector backbone: FUGW
• Backbone manufacturer: Available from Addgene (#14883)
• Backbone size w/o insert (bp): 9941
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: 30o in standard E.coli
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rho/rac guanine nucleotide exchange factor (GEF) 2
• Alt name: shRNA GEF-H1
• Alt name: Arhgef2
• Species: R. norvegicus (rat)
• Insert Size (bp): 70
• GenBank ID: NM_001012079
• Entrez Gene: Arhgef2 (a.k.a. MGC95068)
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Pac I (not destroyed)
• 3′ cloning site: Pac I (not destroyed)
• 5′ sequencing primer: KT581 (ggattggggggtacagtgcaggggaaaga)
• 3′ sequencing primer: KT581 (atcaggaacgctcctgcgccctccgtctga)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry