U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
(Plasmid
#214814)
-
PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATM
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSP1594_2x_NLS (Plasmid #110625)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSt1Cas9 CNRZ1066 v2 targeting ATM
-
gRNA/shRNA sequenceATTAAGTACTAGACTCATGGT
-
SpeciesH. sapiens (human)
-
Entrez GeneATM (a.k.a. AT1, ATA, ATC, ATD, ATDC, ATE, TEL1, TELO1)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTACAGCTCCTGGGCAACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2 was a gift from Yannick Doyon (Addgene plasmid # 214814 ; http://n2t.net/addgene:214814 ; RRID:Addgene_214814)