Skip to main content

U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
(Plasmid #214814)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214814 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSP1594_2x_NLS (Plasmid #110625)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    St1Cas9 CNRZ1066 v2 targeting ATM
  • gRNA/shRNA sequence
    ATTAAGTACTAGACTCATGGT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ATM (a.k.a. AT1, ATA, ATC, ATD, ATDC, ATE, TEL1, TELO1)
  • Promoter CAG

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2 was a gift from Yannick Doyon (Addgene plasmid # 214814 ; http://n2t.net/addgene:214814 ; RRID:Addgene_214814)