U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
(Plasmid
#214814)
-
PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATM
-
Depositing Lab
-
Depositing OrganizationUniversite Laval
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 214814-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 214814-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMSP1594_2x_NLS (Plasmid #110625)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSt1Cas9 CNRZ1066 v2 targeting ATM
-
gRNA/shRNA sequenceATTAAGTACTAGACTCATGGT
-
SpeciesH. sapiens (human)
-
Entrez GeneATM (a.k.a. AT1, ATA, ATC, ATD, ATDC, ATE, TEL1, TELO1)
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTACAGCTCCTGGGCAACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 214814-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 214814-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2 was a gift from Yannick Doyon (Addgene plasmid # 214814 ; http://n2t.net/addgene:214814 ; RRID:Addgene_214814)