Skip to main content

pEK42
(Plasmid #214958)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 214958 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTwist Amp High Copy
  • Backbone manufacturer
    Twist Bioscience
  • Backbone size w/o insert (bp) 2221
  • Total vector size (bp) 7178
  • Vector type
    Bacterial Expression ; Bd gene targeting vector
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    BdGAPDH_LHA2-G4S-HsmRuby3-ScADH1ter
  • Species
    S. cerevisiae (budding yeast), Synthetic; Batrachochytrium dendrobatidis; Entacmaea quadricolor
  • Insert Size (bp)
    2281

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    SpH2Bpro-Hshph-BdGAPDH_RHA2
  • Species
    Synthetic; Spizellomyces punctatus; Batrachochytrium dendrobatidis
  • Insert Size (bp)
    2676
  • Promoter SpH2Bpro

Cloning Information for Gene/Insert 2

  • Cloning method Gene Synthesis
  • 5′ sequencing primer CTTTTATGCTCCAAGCGGAG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.08.29.673073 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEK42 was a gift from Lillian Fritz-Laylin (Addgene plasmid # 214958 ; http://n2t.net/addgene:214958 ; RRID:Addgene_214958)
  • For your References section:

    Homology-mediated transformation of frog-killing fungus Batrachochytrium dendrobatidis illuminates chytrid development and pathogenesis. Brody SM, Kalinka E, Prostak SM, Carvalho T, Man J, James TY, Fritz-Laylin LK. Proc Natl Acad Sci U S A. 2025 Nov 4;122(44):e2507572122. doi: 10.1073/pnas.2507572122. Epub 2025 Oct 28. 10.1073/pnas.2507572122 PubMed 41150711