pEK42
(Plasmid
#214958)
-
PurposeEndogenous tagging of B. dendrobatidis GAPDH with a red fluorescent protein, hygromycin B selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTwist Amp High Copy
-
Backbone manufacturerTwist Bioscience
- Backbone size w/o insert (bp) 2221
- Total vector size (bp) 7178
-
Vector typeBacterial Expression ; Bd gene targeting vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameBdGAPDH_LHA2-G4S-HsmRuby3-ScADH1ter
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Batrachochytrium dendrobatidis; Entacmaea quadricolor
-
Insert Size (bp)2281
Cloning Information for Gene/Insert 1
- Cloning method Gene Synthesis
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSpH2Bpro-Hshph-BdGAPDH_RHA2
-
SpeciesSynthetic; Spizellomyces punctatus; Batrachochytrium dendrobatidis
-
Insert Size (bp)2676
- Promoter SpH2Bpro
Cloning Information for Gene/Insert 2
- Cloning method Gene Synthesis
- 5′ sequencing primer CTTTTATGCTCCAAGCGGAG
- 3′ sequencing primer CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.08.29.673073 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEK42 was a gift from Lillian Fritz-Laylin (Addgene plasmid # 214958 ; http://n2t.net/addgene:214958 ; RRID:Addgene_214958) -
For your References section:
Homology-mediated transformation of frog-killing fungus Batrachochytrium dendrobatidis illuminates chytrid development and pathogenesis. Brody SM, Kalinka E, Prostak SM, Carvalho T, Man J, James TY, Fritz-Laylin LK. Proc Natl Acad Sci U S A. 2025 Nov 4;122(44):e2507572122. doi: 10.1073/pnas.2507572122. Epub 2025 Oct 28. 10.1073/pnas.2507572122 PubMed 41150711