131-2a_HC
(Plasmid
#214965)
-
PurposeExpression monoclonal antibody 131-2a
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214965 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 4999
- Total vector size (bp) 6442
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name131-2a_HC
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1443
- Promoter CMV
-
Tag
/ Fusion Protein
- his8 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer GAAGAGGAAGAAAGGGAAAC
- 3′ sequencing primer CTGTAATTGACAGCCTTGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.01.04.631317 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
131-2a_HC was a gift from Joost Snijder (Addgene plasmid # 214965 ; http://n2t.net/addgene:214965 ; RRID:Addgene_214965) -
For your References section:
Structural basis for postfusion-specific binding to Respiratory Syncytial Virus F protein by the canonical antigenic site I antibody 131-2a. Peng W, Šiborová M, Wu X, Du W, Schulte D, Pronker MF, de Haan CAM, Snijder J. bioRxiv 2025.01.04.631317 10.1101/2025.01.04.631317